PubMed (SuperSkunk X BubbleGum Indica) X Blueberry Sativa, Bluez Cluez (Juan Moore) Blue Widow X Tangerine, Bogglegum (BOG) Northern Lights #5 X Bubblegum, Bombers Widow (Motarebel) [G-13 X Black Widow] X Cherry Bomb II, Bora Lights (GrassrootsRx): Tora Bora x Northern Lights, Bottle Rocket (Reservoir) Killer Queen X DTC 99, Brains Choice (KC Brains) Jamaica Lambsbread 94 X ?Leda Uno 96? and JavaScript. Nevertheless, our meta-data have less bias, because they were obtained in a prospective manner from a population-based study in a central area of Vietnam. 9 (Joker) Love Potion 5 X Northern Lights, Low P.T. S3), and in EAI4_VNM (SIT139, L1.1.1.1) strains of the Thai set, but it was not seen in the Philippine set where EAI4 and ZERO strains were not observed (Figures not shown). Report. PLoS Negl. RYTHM Sativa Dominant PAX Pod Strainbow 500mg Last updated September 1, 2022 Call yourself a canna-seur? From there, it appears that some cultivars had spread to civilized Africa by 700 AD. Increased transmission of Mycobacterium tuberculosis Beijing genotype strains associated with resistance to streptomycin: a population-based study. The study was approved by the Ethics Committee for Biomedical Research, National Hospital of Pediatrics, Vietnam, and the Research Institute of Tuberculosis, Japan Anti-Tuberculosis Association, Japan. The original RD2 locus, which encodes 11 ORFs from Rv1978 to Rv1988, was reported to contribute to Mtb virulence32. Mtb strains without IS6110 copies accounted for 5.0% and all had the ZERO spoligotype in our cohort. Res. Strainbow is a 50/50 indica/sativa hybrid from Spanish breeders Lifetime Seeds, created by crossing Dancehall with Blueberry. Complete genome sequence of a Mycobacterium tuberculosis strain belonging to the East African-Indian family in the Indo-Oceanic lineage isolated in Hanoi, Vietnam. https://doi.org/10.1128/aac.03277-14 (2014). https://doi.org/10.1016/j.vaccine.2010.12.012 (2011). A cannabis connoisseur with a passion for explaining the miraculous possibility of the plant, Swan began her journey with cannabis as a recreational user and quickly realized its positive impact on her depression and severe anxiety. The virus variant with a D amino acid remains more frequent in Asia, where the virus first broke out. Carrying only a few IS6110 copies is also a characteristic of these Vietnamese strains16,19. Genet. Wada, T., Iwamoto, T. & Maeda, S. Genetic diversity of the Mycobacterium tuberculosis Beijing family in East Asia revealed through refined population structure analysis. Couvin, D., David, A., Zozio, T. & Rastogi, N. Macro-geographical specificities of the prevailing tuberculosis epidemic as seen through SITVIT2, an updated version of the Mycobacterium tuberculosis genotyping database. In fact, we dont even know where the first marijuana strain originated from, or when it was first cultivated by humans and crossbred into F1 hybrids. Copyright 2023 MV. Are you new to Florida medical cannabis and unsure how to get started? Named for the numerous colors of the plant while flowering, it has a flavor of spicy, sweet fruit. 16, 196. https://doi.org/10.1186/s12916-018-1180-x (2018). RYTHM RYTHM Hybrid Vape Cartridge Strainbow 500mg 1a). The authors attempt to separate out these effects but have inadequate evidence to say anything conclusive. A recent report demonstrated that the CRISPR locus has variants in direct-repeat and spacer sequences22. Yes! PE_PGRS4 is one of the four PE_PGRS genes with two GRPLI motifs39, and the large deletion spanning the second GRPLI motif is likely to cause structural alteration of the protein. All of them were found in the L1.1.1.1 sublineage defined by the updated SNP-based barcode5. Out of the 838 deduced amino acids of PE_PGRS4 in H37Rv, 382 amino acids, including the second GRPLI motif, were lost by the deletion (Supplementary Fig. Click to show all parents of Rainbow Belts in our dynamic family tree map. provided technical support and sample management. Phenotypic and genotypic features of the BubbleGum = The lineage is Big Skunk with some NL#5 [source = medicine man/OG] Bubbleberry = Bubblegum [female] x Blueberry [male] Bubblefunk = NL#5 x Bubbleberry. RD900, seen in ancestral lineages, was present in majority of the L1 members. Similar to their report, only L1.1.1 and L1.1.1.1 (EAI5, EAI5-like, EAI4_VNM, EAI4_VNM-like, and ZERO strains in our study) had DR1 (GTCGTCAGACCCAAAACCCCGAGAGGGGACGGGAAC, an underlined SNV in the direct repeat), whereas esp38(1) (TGCCCCAGCGTTTAGCGATCACAACACCAACTAATG, an underlined SNV in the spacer) was not observed in ZERO strains as they lost a region spanning spacer 38 (SIT405 and 802). The authors would like to thank Dr. Luu Thi Lien for her advice, Ms. Ikumi Matsushita for her technical support and resource contribution, Ms. Nguyen Thu Huyen, Ms. To Thi Hoai Tho, Ms. Nguyen Thi Ha for their on-site support. 16, 167. https://doi.org/10.1186/s12866-016-0784-6 (2016). Effects are nice. Cite this article. Evolutionary history and global spread of the Mycobacterium tuberculosis Beijing lineage. BMC Bioinf. Nevilles Haze X Panama Red, Red Horse (Goodhouse) [Jack Herer X Top 44] X KGB, Red Widow 13 (Dman) [G13 X Black Widow] X Panama Red, Redhaired Sonja (BlueHemp) [Afghani X Thai] X [Thai X Brazil], Reefer Madness (Reeferman) Mexican a.k.a Blackseed X G13, Reefermans G (Reeferman) Airborne G13 X [Airborne G13 x Santa Marta Columbian Gold], Reefermans Herijuana (Reeferman) SSSCs Herijuana Sativa pheno X SSSCs Herijuana Indica pheno, Reefermans Northern Light (Reeferman) Northern Lights #1 X Reefermans Northern Lights #5, Reefermans Sour Diesel (Reeferman) Sour Diesel X Kush, Reefermans Space Queen (Reeferman) Romulan X Cinderella 99, Remus (Federation) Island Sweet Skunk X Romulan, Renatta (A.C.E.) Announc. All Rights Reserved. It has been suggested that this mutation has led to an increase in the virus transmissibility. Because the RD900 locus contains repetitive sequences, long reads were necessary to determine the exact location. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. The role of IS6110 in the evolution of Mycobacterium tuberculosis. Even though we as humans all belong to a single species (H. sapiens), we can be incredibly different in terms of the way we look, the way we think, the way we feel, and the way we act as individuals. Mtb genotypes vary from population to population and are highly geographically structured7,8,9. Virulence 11, 898915. Mutations occur in all viruses. and our Vir, P., Gupta, D., Agarwal, R. & Verma, I. Interaction of alveolar epithelial cells with CFP21, a mycobacterial cutinase-like enzyme. 7 (Herbaria): Afghan X South African, Colombian Haze (Brazilian Seed): Colombian Gold X Haze Special, Colombian Jack (Brazilian Seed Company): Colombian Gold X Jack Herer, Congo aka Bangi (A.C.E. We have plants that are 18 feet tall and barely flower at all, and we have plants that barely reach four feet off the ground and produce nuggets the size of a pitbulls head. https://doi.org/10.1038/s41598-021-92984-5, DOI: https://doi.org/10.1038/s41598-021-92984-5. She suggests that all marijuana genetics should belong to the single species Cannabis sativa L, and that the relationships between different cultivars should be based solely on genotype. J. Clin. Wiens, K. E. et al. In ZERO strains, in addition to the RD2bcg deletion, a unique 118bp deletion disrupting furA was found, suggesting that ZERO strains evolved from the EAI4_VNM clade. the mitochondrial parent is always the female parent during the backcrossing program. However, with the methods they have used, it is difficult to conclude that the circulating virus with this mutation is more contagious/pathogenic. 72, 3143. Agents Chemother. Rainbow presents a wide array of colors towards the end of flowering, hence the moniker. CAS Read our full review for more! Fortunately, thanks to the combination of science and history we can come up with some pretty accurate guesses. Red Fiery, passionate, sensual - red is a power color that tends to allure the sexes and could possibly give you a promotion. WGS (Illumina) was successful in Mtb isolates from 181 of the 251 patients; L1 accounted for 48.1% (87/181), L2 for 35.3% (64/181), and L4 for 16.6% (30/181). BMC Genom. All ZERO strains that were analyzed did not have any IS6110 elements, and patients infected with these strains had an association with less lung infiltration. We also confirmed the specificity of these two SNVs in Rv0826 and fadE27 in the comparison data sets. & Streeton, J. When L1 strains in Da Nang were assessed by the updated SNP barcoding system5, L1.1.1.1 and L1.1.1 accounted for 89.7% (78/87) and 10.3% (9/87), respectively. performed bacterial culture and DNA extraction from clinical samples. 1 X Airborne G-13] X UBC Chemo, Warpberry (Patch Works): Texada Timewarp X Purple Pineberry, Warrior (Da'Bean Co.): Mango X California Indica, White Cinderella (Canadian Seed Co.): BRG White Widow X Cinderella 99, White Crystal (THC Seeds): White Lightning X Super Crystal, White Fire: OG Kush (Fire cut) X The White Effects, White Flow (Capricorn): White Widow X Flow, White Grizzly (Kootenay Mountain): Dutch Treat X Nepali X Chemo, White Himalayan Haze (GN03): White Widow X Himalayan Haze, White KC (KC Brains): White Widow X Afghani X KC33, White Light (Soma): Bubblegum X White Widow, White Light (Willy Jack): Northern Lights X White Widow, White Lightning (BC Seed Co.): Northern Lights #5 X White Widow, White Mr. Nice (Blue Grass): White Haze X [Mr. Nice G-13 X Hashplant], White Rose (High Quality): Skunk X White Widow, White Satin (Mandala): Landraces; N. India x Punjab, White Star (Capricorn): Sensi Star X White Widow, White Star (Delta 9): New York City Diesel X Sensi Star, White Tusk (Goodhouse): [Hawaii X Big Bud] X KGB, Widow Warrior (White Widow Web): Master Widow X Durban, Widowrella (Canadian Pros): Cinderella 99 X White Widow, Willie G (SOG): Williams Wonder X [O.G.Kush X Pure Kush], Willy Jack (Willy Jack): Williams Wonder X Jack Herer, Wonder 99 (Reservoir): Cinderella 99 X Williams Wonder. provided technical support for WGS. https://doi.org/10.1016/j.cmi.2019.07.016 (2020). Sci. Ok, so on to the actual lineage of cannabis genetics and the historical marijuana family tree. All products are subject to availability depending on the location and region. ): [Congolese X Congolese] X [Chitral X Chitral X Chitral], Conquistador (Subcool): Hashplant X Ortega X Cinderella 99, Continental (A.C.E): Caribbean X Congolese X Pakistani, Cotton Candy (Federation): Afghani X Blueberry, Couchlock (BC Seed Co.): Northern Lights #5 X Afghani #1, Crazy Daze (Dman): Red Haze X [G13 x Black Widow], Cripple Creek (Tom Hill): Pine Tar Kush X Deep Chunk, Critical Hash 47 (Spice Brothers): [Hashplant x Critical Mass] X AK-47, Critical Mass (Mr. Nice): Afghani X Skunk #1, Crown Royal (Federation): Hawaiian Sativa X Mikado, Crystal (Nirvana): White Widow X Northern Lights, Crystal Lightning (White Widow Web): White Widow X Super Thai, Crystal Limit (KC Brains): Crystal X KC 606, Crystal Paradise (KC Brains): Californian BigBud Skunk X Brazil (Mango Vermelho from Brazil, Paranaiba), Crystal Ship, the (Reeferman): Kali Mist X Kodiak Gold, Crystalberry (Cannabis Pros): Blueberry X Northern Light #5, Cyber Bully (Fish Masta Genetics): Alaskan Thunderfuk x Lemon verde, Dark Kush (BlueHemp): Landraces, Hindu Kush Mountains, Dark Vader (BlueHemp): Kush X [Kush X Afghani], Death Star (Ohio): Sensi Star x East Coast Sour Diesel, Desert Queen (No Mercy): Sudden Death # Master Ice X Everest Queen # WK, Dess*Tar (Dynasty): Starship x Kali Myst, Destroyer (Canna Biogen): Meao Thai X [Mexican X Colombian], Devil (Mr. Nice): Afghan X [Afghan X Skunk], Diablo (Next Generation): Blueberry X Grapefruit X South African Sativa, Diamond Head (Sagarmatha): Flow X Atypical Flow, Diesel 39 (Reservoir): M-39 X Sour Diesel, Dirty Harry (Motarebel): Grapefruit Bx1 X Herijuana, Dixie Chicken (Juan Moore): Jacks Cleaner X Airbornes G13, Dixie Crystals (Juan Moore): Aloha 98 White Widow X Cinderella 99, Doc Chronic (Reeferman): Fraser Valley Sativa Hashplant X California Indica, Doctor, the (Greenhouse): Great White Shark X South Indian X SuperSkunk, Dolce Vita (Dutch Passion): Isis X Power Plant, Dope, the (AAA Seeds): Northern Lights #5 X Haze, Double Dutch (Magus): pre-2000 Chronic X Warlock, Double Dutch Haze Skunk (Fleur du Mal): Dutch Haze SkunkX [Haze #19 X Skunk #1], Double Purple Doja (Subcool): Sputnik 1.0 X Black Russian, DTC 99 (Spice Brothers): Durban Thai Highflyer X Cinderella 99, Ducksfoot (WallyDuck): Ducksfoot X Sativa backcrossed to 97% ducksfoot, Durban Poison (Nirvana): South African Sativa X Skunk, Durban Red (Effettoserra): Landraces; Durban X Purple Widow, Durban Thai Highflier (SSSC): Thai X Durban Poison, Dutch Dragon (Paradise): [Durban X Skunk] X California Indica, Early Brambleberry: (Patch Works) Early Bramble X Purple Pineberry, Early Chemo: (Brazilian Seed Company) Early Girl X UBC Chemo, Early Green: (Brazilian Seed Company) Early Green X Original Green, Early White: (Effettoserra) Northern Lights early genotype X White Special early genotype, El Peru: (Blue Grass) El Nino X Peruvian Skunk, Firecracker (SickMeds): Green Crack x Strawberry Fire, Fucking Incredible (Vancouver Island Seed Co.) Burmese X Afghani, G-13 Blue Widow (NCGA) [Blaze x G-13 x Northern Lights] X Blue Widow or G-13 X Blue Widow, G-13 Diesel (Head Seeds) G-13bx X Rezdogs East Coast Sour Diesel v3, Ghandi (High Quality) South Indian X Skunk, Ghaze Bx1 (Dutch Flowers) [G-13 X Uber Candy Haze] X G-13, Giant Cindy (Spice Brothers) Green Giant X Cinderella 99, Giant Princess (Spice Brothers) Green Giant X Ice Princess, Girl Scout Cookies (FRISCO NATIVES): [F-1 Durban X Florida Og kush], God's Treat (Jordan of the Island) Dutch Treat X God Bud, Golden Haze (Dr. Greenthumb) Acapulco Gold X Haze, GoldenMoon (GoldenSeed) GoldenSkunk X Mazar, Gordys Spice #18 (Motarebel) Pacific G-13 X Northern Lights #5, Gourdbuster (Motarebel) City Slicker X Killa Queen, Granflora (Owls Production) Afghan X Purpurea Ticinensis, Grand Poobah: [GDP x Purple Diesel] X Blueberry, Grape Ape (Apothecary Genetics) Afghani X Skunk # 1, Grape Mayhem (Motarebel) Mayhem X Grapefruit Bx1, Grapefruit Haze (Next Generation) Grapefruit X Haze, Grapefruit (Genetics) 75% C'99 X 25% Fruity Sativa, Grapeskunk (Next Generation) Super Skunk X Grapefruit X Blueberry, Grease Monkey (Exotic Genetix) Gorilla Glue #4 x Cookies and Cream, Gummy Berry (Grassroots Rx): Bubble Berry X Bubble Gum Kush, Hash Heaven: (Soma) G13 Hashplant X G13 Haze X Lavender. Internet Explorer). Typical of Sativa strains, Sunshine strain is an excellent mood-enhancer. SwissXT (KC Brains) Mr. Swiss X Double K.C. You will find the link onto the strain-description pages, right below the short overview about the available hybrids. S.Mi. Natl. ADS Sativa Pheno from Herijuana, Killer Queen (Reservoir) Airbornes G13 X Cinderella 99, Killer Queen 2 (Canadian Seed Co.) G13 X Cinderella 99, Killian (Motarebel) Killa Queen X NYC Diesel, Killin Garberville (BC Seed Co.) Hawaiian Sativa X Afghani Indica, Killing Fields (Sannie's Seeds): Jack Herrer x The One, Kings Kross (Reeferman) [King X Charles Kush] X King, King's Kush (Green House) NYC Diesel X Grape X OG Kush, Kiwi (Homegrown Fantaseeds) Landraces; New Zealand, Klingonberry (Dutch Flowers) Bubblegum X Sagarmathas Blueberry X Aloha 98, KO Kush (SensiSeeds): Killa Kush x Herijuana, Kolinahr (Enterprise) Vulcan X White Widow, Kolossus (Sannie's Seeds): Shack x Big White, Kong (Laughing Moon) Kong X [White Russian X BubbleGum], Kranial Kush (Motarebel) Bubba Kush X [Bubba Kush X Yumbolt], Kush Berry (Motarebel) Bubbleberry X [Bubba Kush X Yumbolt], Kwik Kali (Sagarmatha) Western Winds X Stuporsonic, La Nina ( Shantibaba- Mr. Nice) South Indian X Jamaican Sativa X Haze, Lambada (Reeferman) Brazilian X Highland Nepalese, Lambsbread Skunk (Dutch Passion) Jamaican Lambsbread X Skunk #1, Legends Ultimate Indica (Legends) Ortega X Sweet Tooth, Lemon Bud (Canadian Gen.) Monster Bud X Lemon Joy, Lemon Chemo (Woodhorse) BC Chemo X Ontario Chemo, Lemon Diesel (? ) Rhythm- Strainbow Crumble 94.9%, one of bud tenders told me strainbow is a bunch of strains mixed all into one! In terms of the massive amount of strains that exist today, we can likely trace all of them (if we go back far enough) to a single cultivar belonging to the C. sativa L species. The BLAST-based RepUnitTyping tool (https://github.com/NKrit/RepUnitTyping) was utilized for searching the presence or absence of the RD900 locus from the short-read data with a multifasta file made up of six sequences specific to the ABC transporter and pknH2 genes, together with six sequences in adjacent genes as controls (Supplementary Table S3a). An indication that the Indica properties of Sunshine have begun. Acad. Try zooming out to expand the search radius. 5, 4812. https://doi.org/10.1038/ncomms5812 (2014). Hang, N. T. L. et al. 2). Anxiety calming energizing low THC high THC Rainbow, also known as. Biotechnol. This strainbow full spectrum cartridge celebrates the revolutionary LGBTQIA+ community. [The Definitive Guide], What Is CBD Oil? Rainbow Chip Cannabis Strain Information and Review - I Love Growing Keane, V. P., ORourke, T. F., Bollini, P., Pampallona, S. & Siem, H. Prevalence of tuberculosis in Vietnamese migrants: the experience of the Orderly Departure Program. Meeting report: NIH workshop on the Tuberculosis immune epitope database. Crumbz strains Crumbz is known for strains like Trix, Grand Master Kush, ZaZa #20, Exotic Space Dust, Runtz. https://doi.org/10.1128/jcm.02524-12 (2013). The authors would like to thank Enago (www.enago.jp) for the English language review. Article Please click here to see the full Plant-Profile! Chi-squared and Fishers exact tests were performed to compare the frequencies of events among the groups. Many factors could have caused the increased frequency of this mutation and it is very hard to separate them out. Siu, G. K., Yam, W. C., Zhang, Y. Buu, T. N. et al. The RD900 locus had two ORFs that coded for a putative ABC transporter ATP-binding protein and PknH2 (Supplementary Fig. 8, 13101313. https://doi.org/10.3201/eid0811.020291 (2002). In terms of simple marijuana genetics, cannabis has 20 different chromosomes (for reference, humans have 46) with potentially hundreds of different genes existing on each one. Taste the 'Strainbow' With These Colorful Cannabis Pairings Google Scholar. Microbiol. Screening of short-read-sequencing data by RepUnitTyping suggested that all ZERO spoligotype strains did not have traces of any IS6110 copies, whereas the nonZERO strains had at least one copy. Antimicrob. Molecular typing of Mycobacterium tuberculosis isolates from different parts of India based on IS6110 element polymorphism using RFLP analysis. Genotyping of Mycobacterium tuberculosis spreading in Hanoi, Vietnam using conventional and whole genome sequencing methods. Rep. 9, 9305. https://doi.org/10.1038/s41598-019-45566-5 (2019). 16, 1009061. https://doi.org/10.1371/journal.ppat.1009061 (2020). The strains harboring no IS6110 DNA usually belong to ancestral lineages, including L128, although in our cohort, no copies of IS6110 were only found in ZERO strains. In terms of cannabis genetics in Central and South America, we have evidence that Spanish explorers brought the plant to present-day Chile and Peru during the mid-16th century. 58, 60936100. Mycobacterium tuberculosis whole genome sequencing provides insights into the Manila strain and drug-resistance mutations in the Philippines. PLoS ONE 7, e42323. Click and zoom into our map to have all the genetics of Stardawg at one view! Additional characteristics of ZERO strains are shown in Table 3a. Int. https://doi.org/10.1016/j.smim.2014.09.012 (2014). . Speed Queen (Mandala) Landraces, N. India, Himachal Pradesh X?? More Information, By clicking "Post Comment you agree with our, What Is Marijuana Sap? Role of spoligotyping and IS6110-RFLP in assessing genetic diversity of Mycobacterium tuberculosis in India. https://doi.org/10.1007/s11010-014-2154-8 (2014). From the pure landraces up to the last hybrid! PubMed Lets have a look. Our study has some limitations. If you are searching for information about Rainbow Belts from Archive Seed Bank, check out our Basic Infos, Gallery, Strain Reviews, Lineage / Genealogy, Hybrids / Crossbreeds or User Comments for this cannabis variety here at this page and follow the links to get even more information - or list all Rainbow Belts Strains (6) to find a different version. Maeda, S. et al. Southeast Asian J. Trop. Description Rythm Balance Cartridges use the highest quality, full-spectrum cannabis oil, enhanced with superior CCELL hardware. M.H. J. Aust. Coll, F. et al. Das, S., Paramasivan, C. N., Lowrie, D. B., Prabhakar, R. & Narayanan, P. R. IS6110 restriction fragment length polymorphism typing of clinical isolates of Mycobacterium tuberculosis from patients with pulmonary tuberculosis in Madras, south India. Learn more about Hi5 here. List Map. It is well known that the Mtb Beijing lineage harbors a high copy number of IS611050 and is associated with high virulence, extensive drug resistance, and transmission51. Thank you for visiting nature.com. Great cure, not dry, very spongy. ★ Amazing strain highly recommended to anyone who enjoys dank smoke. To refresh your memory, here is a general rundown of the seven major classes of taxonomic classification: Kingdom, Phylum, Class, Order, Family, Genus, Species. Vietnam, located in southeast Asia, is one of 30 countries with a high TB burden. Huyen, M. N. et al. Big BudStrain Lineage & General Info? | International Cannagraphic Jiang, Y. et al. PubMed Central There are over seven billion people living here on earth how many different arrangements exist in terms of our physical appearance? Uplifted Negatives: Dry eyes . Blue Goo (Blue Grass) Blue BubbleJuice X Double G, Blue Hash (Grassroots Rx): Blueberry X California Hashplant, Blue Hun (Blue Grass) Blue Hen X Blue Russian, Blue Jack (Reeferman) Blueberry X Jack Herer X Northern Lights #5, Blue Jamaican (Blue Grass) Marleys Collie X Blue Russian, Blue Kiev (Blue Grass) Blue Russian X AK-47, Blue Kronic (Motarebel) [BlueMoonshine X Killa Queen] X Black Kat, Blue Magoo DJ Short BB X Major League Bud, Blue Moon Rocks (BOG) Blue Moon X BogBubble, Blue Nepalese (Reeferman) Nepalese Sativa X Blueberry Sativa, Blue Pearl (Homegrown Fantaseeds) Silver Pearl X Blue Haze, Blue Rocket (Blue Grass) Blue Rocker X Blue Bubblejuice, Blue Russian (Blue Grass) Blue Hen X Juicy Russian, Blue Skunk X (Mr. Blue) Blueberry X Skunk, Blue Thunder (Sagarmatha) Blueberry X Matanuska Tundra, Blue Thunder (Reeferman) Blueberry Sativa X Kodiak Lavender, Blueberry Blast (Reeferman) Northern Lights #5 X Blueberry Indica, Blueberry Magic (Reeferman) Magic Carpet Ride X Blueberry Sativa, Blueberry NL (Dr. Atomic) Blueberry X Northern Lights, Blueberry Punch (Next Generation) Blueberry X Romulan, Bluebottle (?Xbx?) Truncation of the operons upstream area can confer high level resistance to INH38. For short-read WGS, libraries were prepared with a QIAseq FX DNA Library Kit (QIAGEN) and paired-end sequencing (350bp for read1 and 250bp for read2) was performed using MiSeq (Illumina). Sci. Genome-wide analysis of Mycobacterium tuberculosis polymorphisms reveals lineage-specific associations with drug resistance. They have identified particularly one prevalent mutation (D614G) in the spike protein which would be the target of many vaccines under development; this mutation could be detrimental to the efficacy of those vaccines. The production organism should be non-toxigenic and non-pathogenic, and members of the . This deletion was also identified in EAI4_VNM and ZERO strains of the southern Vietnam cohort (Supplementary Fig. A real decent batch of ground. Please connect it here to the strain info page! Pictures speak louder than words! ? ): Super Skunk X Northern Lights, Lionheart (Almighty) African Sativa X North American Genetics, Lone Ranger (SSSC) Nepali Sativa X Michiocan Mexican Sativa, Love Potion No. Evol. A better understanding of phenotypic variations caused by genetic diversity of Mtb strains is important when attempting to improve TB control measures. X White Widow, Brains Damage (KC Brains) Mexico, Acapulco X [Hawaii 93 X Mango 2001 X KC 36 606], Brains Escape (KC Brains) Edelwuiss X [Brazil, Salvador X KC 606], Brainwreck (HighGrade) Trainwreck X White Widow, Brazil KC (KC Brains) Mango Vermelho, Paranaiba X K.C.